.\" Automatically generated by Pod::Man 4.09 (Pod::Simple 3.35)
.\"
.\" Standard preamble:
.\" ========================================================================
.de Sp \" Vertical space (when we can't use .PP)
.if t .sp .5v
.if n .sp
..
.de Vb \" Begin verbatim text
.ft CW
.nf
.ne \\$1
..
.de Ve \" End verbatim text
.ft R
.fi
..
.\" Set up some character translations and predefined strings.  \*(-- will
.\" give an unbreakable dash, \*(PI will give pi, \*(L" will give a left
.\" double quote, and \*(R" will give a right double quote.  \*(C+ will
.\" give a nicer C++.  Capital omega is used to do unbreakable dashes and
.\" therefore won't be available.  \*(C` and \*(C' expand to `' in nroff,
.\" nothing in troff, for use with C<>.
.tr \(*W-
.ds C+ C\v'-.1v'\h'-1p'\s-2+\h'-1p'+\s0\v'.1v'\h'-1p'
.ie n \{\
.    ds -- \(*W-
.    ds PI pi
.    if (\n(.H=4u)&(1m=24u) .ds -- \(*W\h'-12u'\(*W\h'-12u'-\" diablo 10 pitch
.    if (\n(.H=4u)&(1m=20u) .ds -- \(*W\h'-12u'\(*W\h'-8u'-\"  diablo 12 pitch
.    ds L" ""
.    ds R" ""
.    ds C` ""
.    ds C' ""
'br\}
.el\{\
.    ds -- \|\(em\|
.    ds PI \(*p
.    ds L" ``
.    ds R" ''
.    ds C`
.    ds C'
'br\}
.\"
.\" Escape single quotes in literal strings from groff's Unicode transform.
.ie \n(.g .ds Aq \(aq
.el       .ds Aq '
.\"
.\" If the F register is >0, we'll generate index entries on stderr for
.\" titles (.TH), headers (.SH), subsections (.SS), items (.Ip), and index
.\" entries marked with X<> in POD.  Of course, you'll have to process the
.\" output yourself in some meaningful fashion.
.\"
.\" Avoid warning from groff about undefined register 'F'.
.de IX
..
.if !\nF .nr F 0
.if \nF>0 \{\
.    de IX
.    tm Index:\\$1\t\\n%\t"\\$2"
..
.    if !\nF==2 \{\
.        nr % 0
.        nr F 2
.    \}
.\}
.\"
.\" Accent mark definitions (@(#)ms.acc 1.5 88/02/08 SMI; from UCB 4.2).
.\" Fear.  Run.  Save yourself.  No user-serviceable parts.
.    \" fudge factors for nroff and troff
.if n \{\
.    ds #H 0
.    ds #V .8m
.    ds #F .3m
.    ds #[ \f1
.    ds #] \fP
.\}
.if t \{\
.    ds #H ((1u-(\\\\n(.fu%2u))*.13m)
.    ds #V .6m
.    ds #F 0
.    ds #[ \&
.    ds #] \&
.\}
.    \" simple accents for nroff and troff
.if n \{\
.    ds ' \&
.    ds ` \&
.    ds ^ \&
.    ds , \&
.    ds ~ ~
.    ds /
.\}
.if t \{\
.    ds ' \\k:\h'-(\\n(.wu*8/10-\*(#H)'\'\h"|\\n:u"
.    ds ` \\k:\h'-(\\n(.wu*8/10-\*(#H)'\`\h'|\\n:u'
.    ds ^ \\k:\h'-(\\n(.wu*10/11-\*(#H)'^\h'|\\n:u'
.    ds , \\k:\h'-(\\n(.wu*8/10)',\h'|\\n:u'
.    ds ~ \\k:\h'-(\\n(.wu-\*(#H-.1m)'~\h'|\\n:u'
.    ds / \\k:\h'-(\\n(.wu*8/10-\*(#H)'\z\(sl\h'|\\n:u'
.\}
.    \" troff and (daisy-wheel) nroff accents
.ds : \\k:\h'-(\\n(.wu*8/10-\*(#H+.1m+\*(#F)'\v'-\*(#V'\z.\h'.2m+\*(#F'.\h'|\\n:u'\v'\*(#V'
.ds 8 \h'\*(#H'\(*b\h'-\*(#H'
.ds o \\k:\h'-(\\n(.wu+\w'\(de'u-\*(#H)/2u'\v'-.3n'\*(#[\z\(de\v'.3n'\h'|\\n:u'\*(#]
.ds d- \h'\*(#H'\(pd\h'-\w'~'u'\v'-.25m'\f2\(hy\fP\v'.25m'\h'-\*(#H'
.ds D- D\\k:\h'-\w'D'u'\v'-.11m'\z\(hy\v'.11m'\h'|\\n:u'
.ds th \*(#[\v'.3m'\s+1I\s-1\v'-.3m'\h'-(\w'I'u*2/3)'\s-1o\s+1\*(#]
.ds Th \*(#[\s+2I\s-2\h'-\w'I'u*3/5'\v'-.3m'o\v'.3m'\*(#]
.ds ae a\h'-(\w'a'u*4/10)'e
.ds Ae A\h'-(\w'A'u*4/10)'E
.    \" corrections for vroff
.if v .ds ~ \\k:\h'-(\\n(.wu*9/10-\*(#H)'\s-2\u~\d\s+2\h'|\\n:u'
.if v .ds ^ \\k:\h'-(\\n(.wu*10/11-\*(#H)'\v'-.4m'^\v'.4m'\h'|\\n:u'
.    \" for low resolution devices (crt and lpr)
.if \n(.H>23 .if \n(.V>19 \
\{\
.    ds : e
.    ds 8 ss
.    ds o a
.    ds d- d\h'-1'\(ga
.    ds D- D\h'-1'\(hy
.    ds th \o'bp'
.    ds Th \o'LP'
.    ds ae ae
.    ds Ae AE
.\}
.rm #[ #] #H #V #F C
.\" ========================================================================
.\"
.IX Title "Bio::Tools::Analysis::DNA::ESEfinder 3pm"
.TH Bio::Tools::Analysis::DNA::ESEfinder 3pm "2018-10-27" "perl v5.26.2" "User Contributed Perl Documentation"
.\" For nroff, turn off justification.  Always turn off hyphenation; it makes
.\" way too many mistakes in technical documents.
.if n .ad l
.nh
.SH "NAME"
Bio::Tools::Analysis::DNA::ESEfinder \- a wrapper around ESEfinder
server
.SH "SYNOPSIS"
.IX Header "SYNOPSIS"
.Vb 2
\&  use Bio::Tools::Analysis::DNA::ESEfinder;
\&  use strict;
\&
\&  my $seq; # a Bio::PrimarySeqI or Bio::SeqI object
\&
\&  $seq = Bio::Seq\->new(
\&       \-primary_id => \*(Aqtest\*(Aq,
\&       \-seq=>\*(Aqatgcatgctaggtgtgtgttttgtgggttgtactagctagtgat\*(Aq.
\&       \-alphabet=>\*(Aqdna\*(Aq);
\&
\&  my $ese_finder = Bio::Tools::Analysis::DNA::ESEfinder\->
\&      new(\-seq => $seq);
\&
\&  # run ESEfinder prediction on a DNA sequence
\&  $ese_finder\->run();
\&
\&  die "Could not get a result"
\&      unless $ese_finder\->status =~ /^COMPLETED/;
\&
\&  print $ese_finder\->result;      # print raw prediction to STDOUT
\&
\&  foreach my $feat ( $ese_finder\->result(\*(AqBio::SeqFeatureI\*(Aq) ) {
\&
\&      # do something to SeqFeature
\&      # e.g. print as GFF
\&      print $feat\->gff_string, "\en";
\&      # or store within the sequence \- if it is a Bio::SeqI
\&      $seq\->add_SeqFeature($feat)
\&
\&  }
.Ve
.SH "DESCRIPTION"
.IX Header "DESCRIPTION"
This class is a wrapper around the ESEfinder web server which uses
experimentally defined scoring matrices to identify possible exonic
splicing enhancers in human transcripts.
.PP
The results can be retrieved in 4 ways.
.IP "1." 4
\&\f(CW\*(C`$ese_finder\->result(\*(Aq\*(Aq)\*(C'\fR retrieves the raw text output of the
program
.IP "2." 4
\&\f(CW\*(C`$ese_finder\->result(\*(Aqall\*(Aq)\*(C'\fR returns a Bio::Seq::Meta::Array object
with prediction scores for all residues in the sequence
.IP "3." 4
\&\f(CW\*(C`$ese_finder\->result(\*(AqBio::SeqFeatureI\*(Aq)\*(C'\fR returns an array of
Bio::SeqFeature objects for sequences with significant scores. Feature
tags are score, motif, SR_protein and method
.IP "4." 4
\&\f(CW\*(C`$ese_finder\->result(\*(Aqraw\*(Aq)\*(C'\fR returns an array of significant matches
with each element being a reference to [SR_protein, position, motif, 
score]
.PP
See <http://rulai.cshl.edu/tools/ESE2/>
.PP
This the second implementation of Bio::SimpleAnalysisI which hopefully
will make it easier to write wrappers on various services. This class
uses a web resource and therefore inherits from Bio::WebAgent.
.SH "SEE ALSO"
.IX Header "SEE ALSO"
Bio::SimpleAnalysisI, 
Bio::WebAgent
.SH "FEEDBACK"
.IX Header "FEEDBACK"
.SS "Mailing Lists"
.IX Subsection "Mailing Lists"
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists.  Your participation is much appreciated.
.PP
.Vb 2
\&  bioperl\-l@bioperl.org                  \- General discussion
\&  http://bioperl.org/wiki/Mailing_lists  \- About the mailing lists
.Ve
.SS "Support"
.IX Subsection "Support"
Please direct usage questions or support issues to the mailing list:
.PP
\&\fIbioperl\-l@bioperl.org\fR
.PP
rather than to the module maintainer directly. Many experienced and 
reponsive experts will be able look at the problem and quickly 
address it. Please include a thorough description of the problem 
with code and data examples if at all possible.
.SS "Reporting Bugs"
.IX Subsection "Reporting Bugs"
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution.  Bug reports can be submitted via the
web:
.PP
.Vb 1
\&  https://github.com/bioperl/bioperl\-live/issues
.Ve
.SH "AUTHORS"
.IX Header "AUTHORS"
Richard Adams, Richard.Adams@ed.ac.uk, 
Heikki Lehvaslaiho, heikki-at-bioperl-dot-org
.SH "APPENDIX"
.IX Header "APPENDIX"
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _