NAME¶
Bio::Tools::Analysis::DNA::ESEfinder - a wrapper around ESEfinder server
SYNOPSIS¶
use Bio::Tools::Analysis::DNA::ESEfinder;
use strict;
my $seq; # a Bio::PrimarySeqI or Bio::SeqI object
$seq = Bio::Seq->new(
-primary_id => 'test',
-seq=>'atgcatgctaggtgtgtgttttgtgggttgtactagctagtgat'.
-alphabet=>'dna');
my $ese_finder = Bio::Tools::Analysis::DNA::ESEfinder->
new(-seq => $seq);
# run ESEfinder prediction on a DNA sequence
$ese_finder->run();
die "Could not get a result"
unless $ese_finder->status =~ /^COMPLETED/;
print $ese_finder->result; # print raw prediction to STDOUT
foreach my $feat ( $ese_finder->result('Bio::SeqFeatureI') ) {
# do something to SeqFeature
# e.g. print as GFF
print $feat->gff_string, "\n";
# or store within the sequence - if it is a Bio::SeqI
$seq->add_SeqFeature($feat)
}
DESCRIPTION¶
This class is a wrapper around the ESEfinder web server which uses
experimentally defined scoring matrices to identify possible exonic splicing
enhancers in human transcripts.
The results can be retrieved in 4 ways.
- 1.
- "$ese_finder->result('')" retrieves the raw text output of
the program
- 2.
- "$ese_finder->result('all')" returns a Bio::Seq::Meta::Array
object with prediction scores for all residues in the sequence
- 3.
- "$ese_finder->result('Bio::SeqFeatureI')" returns an array of
Bio::SeqFeature objects for sequences with significant scores. Feature
tags are score, motif, SR_protein and method
- 4.
- "$ese_finder->result('raw')" returns an array of significant
matches with each element being a reference to [SR_protein, position,
motif, score]
See <
http://rulai.cshl.edu/tools/ESE2/>
This the second implentation of Bio::SimpleAnalysisI which hopefully will make
it easier to write wrappers on various services. This class uses a web
resource and therefore inherits from Bio::WebAgent.
SEE ALSO¶
Bio::SimpleAnalysisI, Bio::WebAgent
FEEDBACK¶
Mailing Lists¶
User feedback is an integral part of the evolution of this and other Bioperl
modules. Send your comments and suggestions preferably to one of the Bioperl
mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support¶
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive
experts will be able look at the problem and quickly address it. Please
include a thorough description of the problem with code and data examples if
at all possible.
Reporting Bugs¶
Report bugs to the Bioperl bug tracking system to help us keep track the bugs
and their resolution. Bug reports can be submitted via the web:
https://github.com/bioperl/bioperl-live/issues
AUTHORS¶
Richard Adams, Richard.Adams@ed.ac.uk, Heikki Lehvaslaiho,
heikki-at-bioperl-dot-org
APPENDIX¶
The rest of the documentation details each of the object methods. Internal
methods are usually preceded with a _