'\" t
.\" Title: gt-fingerprint
.\" Author: [FIXME: author] [see http://docbook.sf.net/el/author]
.\" Generator: DocBook XSL Stylesheets v1.78.1
.\" Date: 09/05/2014
.\" Manual: GenomeTools Manual
.\" Source: GenomeTools 1.5.3
.\" Language: English
.\"
.TH "GT\-FINGERPRINT" "1" "09/05/2014" "GenomeTools 1\&.5\&.3" "GenomeTools Manual"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
.\" http://bugs.debian.org/507673
.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
.ie \n(.g .ds Aq \(aq
.el .ds Aq '
.\" -----------------------------------------------------------------
.\" * set default formatting
.\" -----------------------------------------------------------------
.\" disable hyphenation
.nh
.\" disable justification (adjust text to left margin only)
.ad l
.\" -----------------------------------------------------------------
.\" * MAIN CONTENT STARTS HERE *
.\" -----------------------------------------------------------------
.SH "NAME"
gt-fingerprint \- Compute MD5 fingerprints for each sequence given in a set of sequence files\&.
.SH "SYNOPSIS"
.sp
\fBgt fingerprint\fR [option \&...] sequence_file [\&...]
.SH "DESCRIPTION"
.PP
\fB\-check\fR [\fIfilename\fR]
.RS 4
compare all fingerprints contained in the given checklist file with checksums in given sequence_files(s)\&. The comparison is successful, if all fingerprints given in checkfile can be found in the sequence_file(s) in the exact same quantity and vice versa\&. (default: undefined)
.RE
.PP
\fB\-duplicates\fR [\fIyes|no\fR]
.RS 4
show duplicate fingerprints from given sequence_file(s)\&. (default: no)
.RE
.PP
\fB\-extract\fR [\fIstring\fR]
.RS 4
extract the sequence(s) with the given fingerprint from sequence file(s) and show them on stdout\&. (default: undefined)
.RE
.PP
\fB\-width\fR [\fIvalue\fR]
.RS 4
set output width for FASTA sequence printing (0 disables formatting) (default: 0)
.RE
.PP
\fB\-o\fR [\fIfilename\fR]
.RS 4
redirect output to specified file (default: undefined)
.RE
.PP
\fB\-gzip\fR [\fIyes|no\fR]
.RS 4
write gzip compressed output file (default: no)
.RE
.PP
\fB\-bzip2\fR [\fIyes|no\fR]
.RS 4
write bzip2 compressed output file (default: no)
.RE
.PP
\fB\-force\fR [\fIyes|no\fR]
.RS 4
force writing to output file (default: no)
.RE
.PP
\fB\-help\fR
.RS 4
display help and exit
.RE
.PP
\fB\-version\fR
.RS 4
display version information and exit
.RE
.sp
If neither option \fI\-check\fR nor option \fI\-duplicates\fR is used, the fingerprints for all sequences are shown on stdout\&.
.SH "EXAMPLES"
.sp
Compute (unified) list of fingerprints:
.sp
.if n \{\
.RS 4
.\}
.nf
$ gt fingerprint U89959_ests\&.fas | sort | uniq > U89959_ests\&.checklist_uniq
.fi
.if n \{\
.RE
.\}
.sp
Compare fingerprints:
.sp
.if n \{\
.RS 4
.\}
.nf
$ gt fingerprint \-check U89959_ests\&.checklist_uniq U89959_ests\&.fas
950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)
.fi
.if n \{\
.RE
.\}
.sp
Make sure a sequence file contains no duplicates (not the case here):
.sp
.if n \{\
.RS 4
.\}
.nf
$ gt fingerprint \-duplicates U89959_ests\&.fas
950b7715ab6cc030a8c810a0dba2dd33 2
gt fingerprint: error: duplicates found: 1 out of 200 (0\&.500%)
.fi
.if n \{\
.RE
.\}
.sp
Extract sequence with given fingerprint:
.sp
.if n \{\
.RS 4
.\}
.nf
$ gt fingerprint \-extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests\&.fas
>SQ;8720010
TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC
CAACGTAATGGGAGCTTAAAAATA
.fi
.if n \{\
.RE
.\}
.SH "RETURN VALUES"
.sp
.RS 4
.ie n \{\
\h'-04'\(bu\h'+03'\c
.\}
.el \{\
.sp -1
.IP \(bu 2.3
.\}
0 everything went fine (\fI\-check\fR: the comparison was successful;
\fI\-duplicates\fR: no duplicates found)
.RE
.sp
.RS 4
.ie n \{\
\h'-04'\(bu\h'+03'\c
.\}
.el \{\
.sp -1
.IP \(bu 2.3
.\}
1 an error occured (\fI\-check\fR: the comparison was not successful;
\fI\-duplicates\fR: duplicates found)
.RE
.SH "REPORTING BUGS"
.sp
Report bugs to \&.