.\" Automatically generated by Pod::Man 4.09 (Pod::Simple 3.35) .\" .\" Standard preamble: .\" ======================================================================== .de Sp \" Vertical space (when we can't use .PP) .if t .sp .5v .if n .sp .. .de Vb \" Begin verbatim text .ft CW .nf .ne \\$1 .. .de Ve \" End verbatim text .ft R .fi .. .\" Set up some character translations and predefined strings. \*(-- will .\" give an unbreakable dash, \*(PI will give pi, \*(L" will give a left .\" double quote, and \*(R" will give a right double quote. \*(C+ will .\" give a nicer C++. Capital omega is used to do unbreakable dashes and .\" therefore won't be available. \*(C` and \*(C' expand to `' in nroff, .\" nothing in troff, for use with C<>. .tr \(*W- .ds C+ C\v'-.1v'\h'-1p'\s-2+\h'-1p'+\s0\v'.1v'\h'-1p' .ie n \{\ . ds -- \(*W- . ds PI pi . if (\n(.H=4u)&(1m=24u) .ds -- \(*W\h'-12u'\(*W\h'-12u'-\" diablo 10 pitch . if (\n(.H=4u)&(1m=20u) .ds -- \(*W\h'-12u'\(*W\h'-8u'-\" diablo 12 pitch . ds L" "" . ds R" "" . ds C` "" . ds C' "" 'br\} .el\{\ . ds -- \|\(em\| . ds PI \(*p . ds L" `` . ds R" '' . ds C` . ds C' 'br\} .\" .\" Escape single quotes in literal strings from groff's Unicode transform. .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" .\" If the F register is >0, we'll generate index entries on stderr for .\" titles (.TH), headers (.SH), subsections (.SS), items (.Ip), and index .\" entries marked with X<> in POD. Of course, you'll have to process the .\" output yourself in some meaningful fashion. .\" .\" Avoid warning from groff about undefined register 'F'. .de IX .. .if !\nF .nr F 0 .if \nF>0 \{\ . de IX . tm Index:\\$1\t\\n%\t"\\$2" .. . if !\nF==2 \{\ . nr % 0 . nr F 2 . \} .\} .\" .\" Accent mark definitions (@(#)ms.acc 1.5 88/02/08 SMI; from UCB 4.2). .\" Fear. Run. Save yourself. No user-serviceable parts. . \" fudge factors for nroff and troff .if n \{\ . ds #H 0 . ds #V .8m . ds #F .3m . ds #[ \f1 . ds #] \fP .\} .if t \{\ . ds #H ((1u-(\\\\n(.fu%2u))*.13m) . ds #V .6m . ds #F 0 . ds #[ \& . ds #] \& .\} . \" simple accents for nroff and troff .if n \{\ . ds ' \& . ds ` \& . ds ^ \& . ds , \& . ds ~ ~ . ds / .\} .if t \{\ . ds ' \\k:\h'-(\\n(.wu*8/10-\*(#H)'\'\h"|\\n:u" . ds ` \\k:\h'-(\\n(.wu*8/10-\*(#H)'\`\h'|\\n:u' . ds ^ \\k:\h'-(\\n(.wu*10/11-\*(#H)'^\h'|\\n:u' . ds , \\k:\h'-(\\n(.wu*8/10)',\h'|\\n:u' . ds ~ \\k:\h'-(\\n(.wu-\*(#H-.1m)'~\h'|\\n:u' . ds / \\k:\h'-(\\n(.wu*8/10-\*(#H)'\z\(sl\h'|\\n:u' .\} . \" troff and (daisy-wheel) nroff accents .ds : \\k:\h'-(\\n(.wu*8/10-\*(#H+.1m+\*(#F)'\v'-\*(#V'\z.\h'.2m+\*(#F'.\h'|\\n:u'\v'\*(#V' .ds 8 \h'\*(#H'\(*b\h'-\*(#H' .ds o \\k:\h'-(\\n(.wu+\w'\(de'u-\*(#H)/2u'\v'-.3n'\*(#[\z\(de\v'.3n'\h'|\\n:u'\*(#] .ds d- \h'\*(#H'\(pd\h'-\w'~'u'\v'-.25m'\f2\(hy\fP\v'.25m'\h'-\*(#H' .ds D- D\\k:\h'-\w'D'u'\v'-.11m'\z\(hy\v'.11m'\h'|\\n:u' .ds th \*(#[\v'.3m'\s+1I\s-1\v'-.3m'\h'-(\w'I'u*2/3)'\s-1o\s+1\*(#] .ds Th \*(#[\s+2I\s-2\h'-\w'I'u*3/5'\v'-.3m'o\v'.3m'\*(#] .ds ae a\h'-(\w'a'u*4/10)'e .ds Ae A\h'-(\w'A'u*4/10)'E . \" corrections for vroff .if v .ds ~ \\k:\h'-(\\n(.wu*9/10-\*(#H)'\s-2\u~\d\s+2\h'|\\n:u' .if v .ds ^ \\k:\h'-(\\n(.wu*10/11-\*(#H)'\v'-.4m'^\v'.4m'\h'|\\n:u' . \" for low resolution devices (crt and lpr) .if \n(.H>23 .if \n(.V>19 \ \{\ . ds : e . ds 8 ss . ds o a . ds d- d\h'-1'\(ga . ds D- D\h'-1'\(hy . ds th \o'bp' . ds Th \o'LP' . ds ae ae . ds Ae AE .\} .rm #[ #] #H #V #F C .\" ======================================================================== .\" .IX Title "Bio::Tools::Run::StandAloneNCBIBlast 3pm" .TH Bio::Tools::Run::StandAloneNCBIBlast 3pm "2018-09-14" "perl v5.26.2" "User Contributed Perl Documentation" .\" For nroff, turn off justification. Always turn off hyphenation; it makes .\" way too many mistakes in technical documents. .if n .ad l .nh .SH "NAME" Bio::Tools::Run::StandAloneNCBIBlast \- Object for the local execution of the NCBI BLAST program suite (blastall, blastpgp, bl2seq). With experimental support for NCBI rpsblast. .SH "SYNOPSIS" .IX Header "SYNOPSIS" .Vb 1 \& # Do not use directly; see Bio::Tools::Run::StandAloneBlast .Ve .SH "DESCRIPTION" .IX Header "DESCRIPTION" See Bio::Tools::Run::StandAloneBlast .SH "FEEDBACK" .IX Header "FEEDBACK" .SS "Mailing Lists" .IX Subsection "Mailing Lists" User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated. .PP .Vb 2 \& bioperl\-l@bioperl.org \- General discussion \& http://bioperl.org/wiki/Mailing_lists \- About the mailing lists .Ve .SS "Support" .IX Subsection "Support" Please direct usage questions or support issues to the mailing list: .PP \&\fIbioperl\-l@bioperl.org\fR .PP rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible. .SS "Reporting Bugs" .IX Subsection "Reporting Bugs" Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web: .PP .Vb 1 \& https://github.com/bioperl/bioperl\-live/issues .Ve .SH "AUTHOR \- Peter Schattner" .IX Header "AUTHOR - Peter Schattner" Email schattner at alum.mit.edu .SH "MAINTAINER \- Torsten Seemann" .IX Header "MAINTAINER - Torsten Seemann" Email torsten at infotech.monash.edu.au .SH "CONTRIBUTORS" .IX Header "CONTRIBUTORS" Sendu Bala bix@sendu.me.uk (reimplementation) .SH "APPENDIX" .IX Header "APPENDIX" The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ .SS "new" .IX Subsection "new" .Vb 7 \& Title : new \& Usage : my $obj = Bio::Tools::Run::StandAloneBlast\->new(); \& Function: Builds a newBio::Tools::Run::StandAloneBlast object \& Returns : Bio::Tools::Run::StandAloneBlast \& Args : \-quiet => boolean # make program execution quiet \& \-_READMETHOD => \*(AqBLAST\*(Aq (default, synonym \*(AqSearchIO\*(Aq) || \*(Aqblast_pull\*(Aq \& # the parsing method, case insensitive .Ve .PP Essentially all \s-1BLAST\s0 parameters can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional except for \-p in those programs that have it. For a complete listing of settable parameters, run the relevant executable \s-1BLAST\s0 program with the option \*(L"\-\*(R" as in blastall \- Note that the input parameters (\-i, \-j, \-input) should not be set directly by you: this module sets them when you call one of the executable methods. .PP Blastall .PP .Vb 12 \& \-p Program Name [String] \& Input should be one of "blastp", "blastn", "blastx", \& "tblastn", or "tblastx". \& \-d Database [String] default = nr \& The database specified must first be formatted with formatdb. \& Multiple database names (bracketed by quotations) will be accepted. \& An example would be \-d "nr est" \& \-e Expectation value (E) [Real] default = 10.0 \& \-o BLAST report Output File [File Out] Optional, \& default = ./blastreport.out ; set by StandAloneBlast.pm \& \-S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer] \& default = 3 .Ve .PP Blastpgp (including Psiblast) .PP .Vb 6 \& \-j is the maximum number of rounds (default 1; i.e., regular BLAST) \& \-h is the e\-value threshold for including sequences in the \& score matrix model (default 0.001) \& \-c is the "constant" used in the pseudocount formula specified in the paper (default 10) \& \-B Multiple alignment file for PSI\-BLAST "jump start mode" Optional \& \-Q Output File for PSI\-BLAST Matrix in ASCII [File Out] Optional .Ve .PP rpsblast .PP .Vb 7 \& \-d Database [String] default = (none \- you must specify a database) \& The database specified must first be formatted with formatdb. \& Multiple database names (bracketed by quotations) will be accepted. \& An example would be \-d "Cog Smart" \& \-e Expectation value (E) [Real] default = 10.0 \& \-o BLAST report Output File [File Out] Optional, \& default = ./blastreport.out ; set by StandAloneBlast.pm .Ve .PP Bl2seq .PP .Vb 6 \& \-p Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String] \& default = blastp \& \-o alignment output file [File Out] default = stdout \& \-e Expectation value (E) [Real] default = 10.0 \& \-S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer] \& default = 3 .Ve .SS "blastall" .IX Subsection "blastall" .Vb 10 \& Title : blastall \& Usage : $blast_report = $factory\->blastall(\*(Aqt/testquery.fa\*(Aq); \& or \& $input = Bio::Seq\->new(\-id=>"test query", \& \-seq=>"ACTACCCTTTAAATCAGTGGGGG"); \& $blast_report = $factory\->blastall($input); \& or \& $seq_array_ref = \e@seq_array; \& # where @seq_array is an array of Bio::Seq objects \& $blast_report = $factory\->blastall($seq_array_ref); \& Returns : Reference to a Blast object containing the blast report. \& Args : Name of a file or Bio::Seq object or an array of \& Bio::Seq object containing the query sequence(s). \& Throws an exception if argument is not either a string \& (eg a filename) or a reference to a Bio::Seq object \& (or to an array of Seq objects). If argument is string, \& throws exception if file corresponding to string name can \& not be found. .Ve .SS "blastpgp" .IX Subsection "blastpgp" .Vb 10 \& Title : blastpgp \& Usage : $blast_report = $factory\-> blastpgp(\*(Aqt/testquery.fa\*(Aq); \& or \& $input = Bio::Seq\->new(\-id=>"test query", \& \-seq=>"ACTADDEEQQPPTCADEEQQQVVGG"); \& $blast_report = $factory\->blastpgp ($input); \& or \& $seq_array_ref = \e@seq_array; \& # where @seq_array is an array of Bio::Seq objects \& $blast_report = $factory\-> blastpgp(\e@seq_array); \& Returns : Reference to a Bio::SearchIO object containing the blast report \& Args : Name of a file or Bio::Seq object. In psiblast jumpstart \& mode two additional arguments are required: a SimpleAlign \& object one of whose elements is the query and a "mask" to \& determine how BLAST should select scoring matrices see \& DESCRIPTION above for more details. \& \& Throws an exception if argument is not either a string \& (eg a filename) or a reference to a Bio::Seq object \& (or to an array of Seq objects). If argument is string, \& throws exception if file corresponding to string name can \& not be found. \& Returns : Reference to Bio::SearchIO object containing the blast report. .Ve .SS "rpsblast" .IX Subsection "rpsblast" .Vb 10 \& Title : rpsblast \& Usage : $blast_report = $factory\->rpsblast(\*(Aqt/testquery.fa\*(Aq); \& or \& $input = Bio::Seq\->new(\-id=>"test query", \& \-seq=>"MVVLCRADDEEQQPPTCADEEQQQVVGG"); \& $blast_report = $factory\->rpsblast($input); \& or \& $seq_array_ref = \e@seq_array; \& # where @seq_array is an array of Bio::Seq objects \& $blast_report = $factory\->rpsblast(\e@seq_array); \& Args : Name of a file or Bio::Seq object or an array of \& Bio::Seq object containing the query sequence(s). \& Throws an exception if argument is not either a string \& (eg a filename) or a reference to a Bio::Seq object \& (or to an array of Seq objects). If argument is string, \& throws exception if file corresponding to string name can \& not be found. \& Returns : Reference to a Bio::SearchIO object containing the blast report .Ve .SS "bl2seq" .IX Subsection "bl2seq" .Vb 11 \& Title : bl2seq \& Usage : $factory\-> bl2seq(\*(Aqt/seq1.fa\*(Aq, \*(Aqt/seq2.fa\*(Aq); \& or \& $input1 = Bio::Seq\->new(\-id=>"test query1", \& \-seq=>"ACTADDEEQQPPTCADEEQQQVVGG"); \& $input2 = Bio::Seq\->new(\-id=>"test query2", \& \-seq=>"ACTADDEMMMMMMMDEEQQQVVGG"); \& $blast_report = $factory\->bl2seq ($input1, $input2); \& Returns : Reference to a BPbl2seq object containing the blast report. \& Args : Names of 2 files or 2 Bio::Seq objects containing the \& sequences to be aligned by bl2seq. \& \& Throws an exception if argument is not either a pair of \& strings (eg filenames) or references to Bio::Seq objects. \& If arguments are strings, throws exception if files \& corresponding to string names can not be found. .Ve .SS "_generic_local_blast" .IX Subsection "_generic_local_blast" .Vb 4 \& Title : _generic_local_blast \& Usage : internal function not called directly \& Returns : Bio::SearchIO \& Args : Reference to calling object and name of BLAST executable .Ve .SS "_runblast" .IX Subsection "_runblast" .Vb 7 \& Title : _runblast \& Usage : Internal function, not to be called directly \& Function: makes actual system call to Blast program \& Example : \& Returns : Report Bio::SearchIO object in the appropriate format \& Args : Reference to calling object, name of BLAST executable, \& and parameter string for executable .Ve .SS "_setparams" .IX Subsection "_setparams" .Vb 6 \& Title : _setparams \& Usage : Internal function, not to be called directly \& Function: Create parameter inputs for Blast program \& Example : \& Returns : parameter string to be passed to Blast \& Args : Reference to calling object and name of BLAST executable .Ve