.\" Automatically generated by Pod::Man 4.14 (Pod::Simple 3.42) .\" .\" Standard preamble: .\" ======================================================================== .de Sp \" Vertical space (when we can't use .PP) .if t .sp .5v .if n .sp .. .de Vb \" Begin verbatim text .ft CW .nf .ne \\$1 .. .de Ve \" End verbatim text .ft R .fi .. .\" Set up some character translations and predefined strings. \*(-- will .\" give an unbreakable dash, \*(PI will give pi, \*(L" will give a left .\" double quote, and \*(R" will give a right double quote. \*(C+ will .\" give a nicer C++. Capital omega is used to do unbreakable dashes and .\" therefore won't be available. \*(C` and \*(C' expand to `' in nroff, .\" nothing in troff, for use with C<>. .tr \(*W- .ds C+ C\v'-.1v'\h'-1p'\s-2+\h'-1p'+\s0\v'.1v'\h'-1p' .ie n \{\ . ds -- \(*W- . ds PI pi . if (\n(.H=4u)&(1m=24u) .ds -- \(*W\h'-12u'\(*W\h'-12u'-\" diablo 10 pitch . if (\n(.H=4u)&(1m=20u) .ds -- \(*W\h'-12u'\(*W\h'-8u'-\" diablo 12 pitch . ds L" "" . ds R" "" . ds C` "" . ds C' "" 'br\} .el\{\ . ds -- \|\(em\| . ds PI \(*p . ds L" `` . ds R" '' . ds C` . ds C' 'br\} .\" .\" Escape single quotes in literal strings from groff's Unicode transform. .ie \n(.g .ds Aq \(aq .el .ds Aq ' .\" .\" If the F register is >0, we'll generate index entries on stderr for .\" titles (.TH), headers (.SH), subsections (.SS), items (.Ip), and index .\" entries marked with X<> in POD. Of course, you'll have to process the .\" output yourself in some meaningful fashion. .\" .\" Avoid warning from groff about undefined register 'F'. .de IX .. .nr rF 0 .if \n(.g .if rF .nr rF 1 .if (\n(rF:(\n(.g==0)) \{\ . if \nF \{\ . de IX . tm Index:\\$1\t\\n%\t"\\$2" .. . if !\nF==2 \{\ . nr % 0 . nr F 2 . \} . \} .\} .rr rF .\" .\" Accent mark definitions (@(#)ms.acc 1.5 88/02/08 SMI; from UCB 4.2). .\" Fear. Run. Save yourself. No user-serviceable parts. . \" fudge factors for nroff and troff .if n \{\ . ds #H 0 . ds #V .8m . ds #F .3m . ds #[ \f1 . ds #] \fP .\} .if t \{\ . ds #H ((1u-(\\\\n(.fu%2u))*.13m) . ds #V .6m . ds #F 0 . ds #[ \& . ds #] \& .\} . \" simple accents for nroff and troff .if n \{\ . ds ' \& . ds ` \& . ds ^ \& . ds , \& . ds ~ ~ . ds / .\} .if t \{\ . ds ' \\k:\h'-(\\n(.wu*8/10-\*(#H)'\'\h"|\\n:u" . ds ` \\k:\h'-(\\n(.wu*8/10-\*(#H)'\`\h'|\\n:u' . ds ^ \\k:\h'-(\\n(.wu*10/11-\*(#H)'^\h'|\\n:u' . ds , \\k:\h'-(\\n(.wu*8/10)',\h'|\\n:u' . ds ~ \\k:\h'-(\\n(.wu-\*(#H-.1m)'~\h'|\\n:u' . ds / \\k:\h'-(\\n(.wu*8/10-\*(#H)'\z\(sl\h'|\\n:u' .\} . \" troff and (daisy-wheel) nroff accents .ds : \\k:\h'-(\\n(.wu*8/10-\*(#H+.1m+\*(#F)'\v'-\*(#V'\z.\h'.2m+\*(#F'.\h'|\\n:u'\v'\*(#V' .ds 8 \h'\*(#H'\(*b\h'-\*(#H' .ds o \\k:\h'-(\\n(.wu+\w'\(de'u-\*(#H)/2u'\v'-.3n'\*(#[\z\(de\v'.3n'\h'|\\n:u'\*(#] .ds d- \h'\*(#H'\(pd\h'-\w'~'u'\v'-.25m'\f2\(hy\fP\v'.25m'\h'-\*(#H' .ds D- D\\k:\h'-\w'D'u'\v'-.11m'\z\(hy\v'.11m'\h'|\\n:u' .ds th \*(#[\v'.3m'\s+1I\s-1\v'-.3m'\h'-(\w'I'u*2/3)'\s-1o\s+1\*(#] .ds Th \*(#[\s+2I\s-2\h'-\w'I'u*3/5'\v'-.3m'o\v'.3m'\*(#] .ds ae a\h'-(\w'a'u*4/10)'e .ds Ae A\h'-(\w'A'u*4/10)'E . \" corrections for vroff .if v .ds ~ \\k:\h'-(\\n(.wu*9/10-\*(#H)'\s-2\u~\d\s+2\h'|\\n:u' .if v .ds ^ \\k:\h'-(\\n(.wu*10/11-\*(#H)'\v'-.4m'^\v'.4m'\h'|\\n:u' . \" for low resolution devices (crt and lpr) .if \n(.H>23 .if \n(.V>19 \ \{\ . ds : e . ds 8 ss . ds o a . ds d- d\h'-1'\(ga . ds D- D\h'-1'\(hy . ds th \o'bp' . ds Th \o'LP' . ds ae ae . ds Ae AE .\} .rm #[ #] #H #V #F C .\" ======================================================================== .\" .IX Title "Bio::Graphics::Browser2::Realign 3pm" .TH Bio::Graphics::Browser2::Realign 3pm "2022-09-30" "perl v5.34.0" "User Contributed Perl Documentation" .\" For nroff, turn off justification. Always turn off hyphenation; it makes .\" way too many mistakes in technical documents. .if n .ad l .nh .SH "NAME" Bio::Graphics::Browser2::Realign \- Perl extension for Smith\-Waterman alignments .SH "SYNOPSIS" .IX Header "SYNOPSIS" .Vb 3 \& use Bio::Graphics::Browser2::Realign \*(Aqalign\*(Aq; \& my ($top,$middle,$bottom) = align(\*(Aqgattttttc\*(Aq,\*(Aqgattttccc\*(Aq); \& print join "\en",$top,$middle,$bottom,"\en"; \& \& # produces: \& gatttttt\-\-c \& |||||| | \& gatttt\-\-ccc .Ve .SH "DESCRIPTION" .IX Header "DESCRIPTION" This is a helper utility used by gbrowse to produce global alignments. It uses slow Smith-Waterman, so is only appropriate for short segments that are mostly aligned already. .PP It can be speeded up significantly by compiling Bio::Graphics::Browser2::CAlign, an \s-1XS\s0 extension. To do this, build gbrowse with the DO_XS=1 option: .PP .Vb 2 \& cd Generic\-Genome\-Browser \& perl Makefile.PL DO_XS=1 .Ve .SS "\s-1METHODS\s0" .IX Subsection "METHODS" .ie n .IP "$aligner = Bio::Graphics::Browser2::Realign\->new($src,$target [,\e%matrix])" 4 .el .IP "\f(CW$aligner\fR = Bio::Graphics::Browser2::Realign\->new($src,$target [,\e%matrix])" 4 .IX Item "$aligner = Bio::Graphics::Browser2::Realign->new($src,$target [,%matrix])" The \fBnew()\fR method takes two the two sequence strings to be aligned and an optional weight matrix. Legal weight matrix keys and their default values are shown here: .Sp .Vb 2 \& Key name Default Description \& \-\-\-\-\-\-\-\- \-\-\-\-\-\-\- \-\-\-\-\-\-\-\-\-\-\- \& \& match 1 Award one point for an exact match. \& mismatch \-1 Penalize one point for a mismatch. \& wildcard_match 0 No penalty for a match to a wildcard (e.g. "n"). \& gap \-1 Penalize one point to create a gap. \& gap_extend 0 No penalty for extending an existing gap. \& wildcard \*(AqN\*(Aq The wildcard character. .Ve .Sp The alignment algorithm is run when \fBnew()\fR is called. .ie n .IP "$score = $aligner\->score" 4 .el .IP "\f(CW$score\fR = \f(CW$aligner\fR\->score" 4 .IX Item "$score = $aligner->score" Return the score from the alignment. .ie n .IP "$start = $aligner\->start" 4 .el .IP "\f(CW$start\fR = \f(CW$aligner\fR\->start" 4 .IX Item "$start = $aligner->start" Return the start of the aligned region, in source sequence coordinates. .ie n .IP "$end = $aligner\->end" 4 .el .IP "\f(CW$end\fR = \f(CW$aligner\fR\->end" 4 .IX Item "$end = $aligner->end" Return the end of the aligned region, in source sequence coordinates. .ie n .IP "$arrayref = $aligner\->alignment" 4 .el .IP "\f(CW$arrayref\fR = \f(CW$aligner\fR\->alignment" 4 .IX Item "$arrayref = $aligner->alignment" Return an arrayref representing the alignment. The array will be exactly as long as the source sequence. Its indexes correspond to positions on the source sequence, and its values correspond to positions on the target sequence. An unaligned base is indicated as undef. Indexes are zero-based. .Sp For example, this alignment: .Sp .Vb 3 \& gatttttt\-\-c \& |||||| | \& gatttt\-\-ccc .Ve .Sp corresponds to this arrayref: .Sp .Vb 10 \& index value \& 0[g] 0[g] \& 1[a] 1[a] \& 2[t] 2[t] \& 3[t] 3[t] \& 4[t] 4[t] \& 5[t] 5[t] \& 6[t] undef \& 7[t] undef \& 8[c] 8[c] .Ve .ie n .IP "($top,$middle,$bottom) = $aligner\->pads" 4 .el .IP "($top,$middle,$bottom) = \f(CW$aligner\fR\->pads" 4 .IX Item "($top,$middle,$bottom) = $aligner->pads" Returns the alignment as three padded strings indicating the top, middle and bottom lines of a pretty-printed representation. .Sp For example: .Sp .Vb 1 \& print join "\en",$aligner\->pads; .Ve .Sp Will produce this output: .Sp .Vb 3 \& gatttttt\-\-c \& |||||| | \& gatttt\-\-ccc .Ve .SS "\s-1EXPORTED METHODS\s0" .IX Subsection "EXPORTED METHODS" No functions are exported by default, but the following two methods can be imported explicitly. .IP "($top,$middle,$bottom) = align($source,$target [,\e%matrix])" 4 .IX Item "($top,$middle,$bottom) = align($source,$target [,%matrix])" Align the source and target sequences and return the padded strings representing the alignment. It is exactly equivalent to calling: .Sp .Vb 1 \& Bio::Graphics::Browser2::Realign\->new($source,$target)\->pads; .Ve .ie n .IP "$segs_arrayref = align_segs($source,$target [,\e%matrix])" 4 .el .IP "\f(CW$segs_arrayref\fR = align_segs($source,$target [,\e%matrix])" 4 .IX Item "$segs_arrayref = align_segs($source,$target [,%matrix])" The \fBalign_segs()\fR function aligns \f(CW$source\fR and \f(CW$target\fR and returns an array of non-gapped segments. Each element of the array corresponds to a contiguous nongapped alignment in the format [src_start,src_end,tgt_start,tgt_end]. .Sp This is useful for converting a gapped alignment into a series of nongapped alignments. .Sp In a list context this function will return a list of non-gapped segments. .ie n .IP "$segs_arrayref = Bio::Graphics::Browser2::Realign\->pads_to_segments($seq1,$pads,$seq2)" 4 .el .IP "\f(CW$segs_arrayref\fR = Bio::Graphics::Browser2::Realign\->pads_to_segments($seq1,$pads,$seq2)" 4 .IX Item "$segs_arrayref = Bio::Graphics::Browser2::Realign->pads_to_segments($seq1,$pads,$seq2)" This class method takes two padded sequence strings and the alignment string that relates them and returns an array ref of non-gapped aligned sequence in the format: .Sp .Vb 1 \& [src_start,src_end,tgt_start,tgt_end] .Ve .Sp The 3 strings look like this CA-ACCCCCTTGCAACAACCTTGAGAACCCCAGGGA | ||||||||||||||||||||||||||||||||| \s-1AAGACCCCCTTGCAACAACCTTGAGAACCCCAGGGA\s0 .SH "AUTHOR" .IX Header "AUTHOR" Lincoln Stein . .PP Copyright (c) 2003 Cold Spring Harbor Laboratory .PP This library is free software; you can redistribute it and/or modify it under the same terms as Perl itself. See \s-1DISCLAIMER\s0.txt for disclaimers of warranty. .SH "SEE ALSO" .IX Header "SEE ALSO" Bio::Graphics::Browser.